Preprocessing of samples prepared with Illumina TruSeq):

• Detect the adapter sequence: TGGAATTCTCGGGTGCCAAGGG
• Minimum length of adapter sequence that needs to be aligned: 10
• Allowed mismatches between adapter and reference sequences: 1

Preprocessing of samples prepared with NEBNext):

• Detect the adapter sequence: AGATCGGAAGAGCACACGTCT
• Minimum length of adapter sequence that needs to be aligned: 10
• Allowed mismatches between adapter and reference sequences: 1

Preprocessing of samples prepared with NEXTFLEX v2/v3):

• Remove 4 nt barcode from 5' end of reads
• Detect the adapter sequence: TGGAATTCTCGGGTGCCAAGGG
• Minimum length of adapter sequence that needs to be aligned: 10
• Allowed mismatches between adapter and reference sequences: 1
• Remove 4 nt random adapter from 3' end of adapter trimmed reads

Preprocessing of samples prepared with SMARTer (Clonetech)):

• Perform a iterative trimming of the 5' end of the read by means of iteratively aligning the reads to the genome sequence trimming unmapped reads by 1 nt (4 rounds of trimming).
• Detect the adapter sequence: AAAAAAAAAAAA
• Minimum length of adapter sequence that needs to be aligned: 10
• Allowed mismatches between adapter and reference sequences: 1

Preprocessing of samples prepared with QIAseq (Qiagen)):

• Detect the adapter sequence AACTGTAGGCACCATCAAT and the position of the UMIs
• Merge fragment and UMI sequences and remove duplicates
• Remove UMIs from the reads

mirnaQC will try to automatically detect protocol and species from your data but if you provide these, your job will run faster.

miRNA-seq protocols that can be detected:

• Illumina TrueSeq™ (280916)
• NEBnext™
• Clonetech SMARTer™
• Qiagen™ (with UMIs)

mirnaQC can work with 3 types of input and you can provide one or several samples:

• Upload a reads file (typically fastq or fastq.gz) E.g: IK_exo.fastq.gz
• Provide a link to a reads file (typically fastq or fastq.gz) E.g: https://arn.ugr.es/srnatoolbox/static/IK_exosomes.fastq.gz
• Provide an accession for a SRA run (they start with SRR,ERR or DRR e.g. SRR1563062)